Katia Queiroz. Tecnologia do Blogger.

22 de jul de 2016

ASSUNTOS QUE MAIS CAEM NO ENEM - BIOTECNOLOGIA

01. (UFAL) A tecnologia do DNA recombinante tem produzido uma série de avanços no setor agropecuário brasileiro. A inserção de um gene da bactéria Bacillus thuringiensis em algumas variedades de plantas, por exemplo, as torna resistentes a certas pragas. Sobre essas tecnologias, é correto afirmar:
a) A transferência de qualquer gene de um organismo a outro produz variabilidade genética; daí, os transgênicos serem resistentes a pragas.
b) Plasmídios virais são utilizados como vetores de genes de interesse que serão transferidos a um organismo.
c) A resistência de uma planta transgênica a uma praga se deve à ação do produto do gene inserido na planta, e não à presença do gene em si.
d) Plantas naturalmente resistentes a pragas não passam necessariamente esta característica à prole; daí, a necessidade das técnicas de engenharia genética.
e) A clonagem de plantas com características de resistência a pragas as torna menos susceptíveis à extinção ao longo da evolução, segundo as leis da seleção natural.
02. (UEL) Pesquisas recentes mostraram que células-tronco retiradas da medula óssea de indivíduos com problemas cardíacos foram capazes de reconstituir o músculo do coração, o que abre perspectivas de tratamento para pessoas com problemas cardíacos. Células-tronco também podem ser utilizadas no tratamento de doenças genéticas, como as doenças neuromusculares degenerativas. A expectativa em torno da utilização das células-tronco decorre do fato de que essas células:
a) Incorporam o genoma do tecido lesionado, desligando os genes deletérios.
b) Eliminam os genes causadores da doença no tecido lesionado, reproduzindo-se com facilidade.
c) Alteram a constituição genética do tecido lesionado, pelo alto grau de especialização.
d) Sofrem diferenciação, tornando-se parte integrante e funcional do tecido lesionado.
e) Fundem-se com o tecido lesionado, eliminando as possibilidades de rejeição imunológica.
03. (UEM) Sobre os ácidos nucleicos, assinale o que for correto.
I   II
0  0 – Na engenharia genética, as enzimas de restrição, produzidas por diversos organismos, são utilizadas para cortar uma sequência específica de DNA.
1  1 – A produção de insulina, via atividade bacteriana, foi possível ao se introduzir fragmentos de DNA humano no plasmídio das bactérias.
2  2 – Os transgênicos (organismos geneticamente modificados) contêm, em seus cromossomos, DNA de outra espécie.
3  3 – Na clonagem de animais e vegetais, é necessário reduzir o número de cromossomos para evitar a poliploidia.
4  4 – A paternidade pode ser comprovada quando houver coincidência das bandas obtidas do RNA do homem e da criança.
04. Desde a Antiguidade, os empreendedores já fabricavam vinho, cerveja, pão, queijo e outros produtos por meio da fermentação. De lá para cá, muitas técnicas foram desenvolvidas e aplicadas aos processos biológicos de produção de substâncias para os mais variados fins. É a biotecnologia. A partir da década de 1970, a biotecnologia concentrou suas atenções nas pesquisas com o DNA (material genético), e com isso foi possível criar os organismos geneticamente modificados, conhecidos como transgênicos. Depois do sucesso obtido na transferência de genes de uma espécie para outra, foi possível evoluir e aplicar técnicas para a criação de medicamentos, hormônios, plantas modificadas e outros produtos. Analise as afirmações a seguir e assinale a correta.
a) Os organismos transgênicos recebem e expressam genes de outras espécies.
b) Os organismos geneticamente modificados são obtidos a partir da fermentação.
c) A fabricação de pão e de queijo ocorre principalmente pela utilização de organismos transgênicos.
d) Os organismos transgênicos não transferem as novas características adquiridas para as próximas gerações.
e) A técnica de produção dos transgênicos é realizada apenas entre as espécies que pertencem ao mesmo reino.
05. (PUC-RS)
RESPONDA ESTA QUESTÃO COM BASE NAS INFORMAÇÕES, FIGURA E AFIRMATIVAS ABAIXO.
O Brasil é o segundo maior produtor de culturas biotecnológicas do mundo, atrás somente dos Estados Unidos da América (ISAAA, 2009). Culturas biotecnológicas com ação inseticida, como o Milho Bt, produzem uma toxina chamada de Bt, que age matando especificamente insetos praga do milho. Dessa forma, é esperado que as plantas de Milho Bt promovam uma elevada mortalidade nas populações naturais de insetos praga, levando a uma diminuição dessas populações em curto prazo. Contudo, sabe-se que em longo prazo irão surgir insetos praga resistentes a esta toxina Bt. A melhor estratégia para reduzir o aparecimento dessas pragas resistentes é o uso de refúgios em lavoura com Milho Bt. O refúgio pode ser definido como uma área cultivada com milho tradicional, na qual a praga alvo tenha condições de sobrevivência e de reprodução.
A figura abaixo ilustra a estratégia dos refúgios.
05
Sobre essa situação, afirma-se:
I. A toxina Bt age como pressão de seleção para o surgimento de insetos praga sensíveis ao Bt.
II. A relação que existe entre insetos tolerantes e insetos sensíveis ao Bt é a comensal.
III. O refúgio possibilita a produção de insetos praga e favorece o acasalamento ao acaso com indivíduos provenientes de áreas com plantas Bt.
IV. A estratégia de utilizar refúgios reduz a probabilidade de que os insetos praga desenvolvam resistência à proteína inseticida Bt.
Interpretando as informações, conclui-se que estão corretas apenas as afirmativas:
a) I e II.
b) I e IV.
c) II e III.
d) III e IV.
e) I, II e III.
06. (UNIVASF) Entre os produtos farmacêuticos obtidos por manipulação genética, estão: o hormônio de crescimento humano e a insulina. Na obtenção desses produtos, são empregadas:
1. Enzimas de restrição, que reconhecem e rompem determinadas sequências de nucleotídeos componentes de moléculas de DNA.
2. Endonucleases de restrição, eficazes na religadura de segmentos cortados de DNA plasmidial bacteriano com o DNA humano.
3. Exonucleases de restrição, eficientes como sondas genéticas na identificação de segmentos plasmidiais de bactérias inseridos em cromossomos de outros organismos.
4. Técnicas de manipulação do DNA, também conhecidas como Engenharia Genética ou tecnologia do DNA recombinante.
Estão corretas:
a) 1, 2, 3 e 4.
b) 1 e 3, apenas.
c) 1 e 4, apenas.
d) 2 e 3, apenas.
e) 3 e 4, apenas.
07. (UFLA) O uso de alimentos transgênicos na alimentação humana tem sido alvo de críticas por parte de vários setores da sociedade, os quais argumentam que esses alimentos apresentam riscos potenciais à saúde, já que ainda não foram devidamente verificados. Qual das alternativas abaixo aponta uma explicação genética adequada para esse possível risco?
a) Pelo fato de ser uma mistura aleatória de DNA de organismos incompatíveis, esse alimento apresenta composições muito alteradas e baixo valor nutritivo, quando comparado com o não-transgênico.
b) Os genes exóticos inseridos artificialmente no alimento transgênico passarão a fazer parte do DNA das células do ser humano que se alimentar dele, causando sérios distúrbios de funcionamento no organismo dessa pessoa.
c) Como no alimento transgênico existe pelo menos um gene de outro organismo, esse alimento apresenta em sua composição pelo menos uma proteína diferente, não característica, que pode vir a causar reações adversas não observadas quando se ingerem alimentos não modificados.
d) Como a transgenia muda completamente a informação genética característica da espécie, o alimento fica completamente adulterado, podendo conter substâncias venenosas.
e) A inserção de RNA e proteínas nas moléculas de DNA pode levar à produção de moléculas inibidoras da expressão dos genes. Essas moléculas podem vir a atuar no organismo da pessoa que o ingerir e causar diversos tipos de disfunções.
08. (PUC-RJ) Em 1990, foi oficialmente iniciado o Projeto Genoma, que visa decifrar e mapear o código genético humano. Indique a alternativa errada relativa ao código genético e à síntese de proteínas:
a) Os genes são formados por ácido desoxirribonucleico e controlam a produção de proteínas da célula, determinando as características de um ser vivo.
b) Todas as células do corpo têm a mesma coleção de genes, mas, apesar disto, encontramos células com formas e funções diferentes.
c) A mutação é uma alteração do código genético de um organismo e pode ser provocada por radiações ou substâncias químicas.
d) As mudanças na programação genética de um organismo não alteram a produção de proteínas, nem as suas características.
e) A Engenharia Genética, que é uma técnica de manipulação dos genes, pode corrigir defeitos no código genético de um organismo.
09. (UEL)        LEIA O TEXTO A SEGUIR E RESPONDA ESTA QUESTÃO.
Doping pode ser compreendido como a utilização de substâncias ou método que possa melhorar o desempenho esportivo e atente contra a ética esportiva em determinado tempo e lugar, com ou sem prejuízo à saúde do esportista. Em uma época em que as ciências do esporte aportam cada vez mais decisivamente elementos para a melhoria do desempenho esportivo dos praticantes de esporte de alto rendimento, em particular, e de atividades físicas, em geral, ganham em importância discussões acerca da utilização de metodologias biomoleculares e substâncias em suas mais amplas aplicações. Quer do ponto de vista sanitário ou ético, o doping genético tem suscitado debates tão intensos quanto questionáveis do ponto de vista científico. A questão que se coloca consiste em indagar se o recurso obtido com tecnologias biomoleculares se choca com a ideia de espírito esportivo, essência do Olimpismo, pautado pela busca do equilíbrio entre corpo, mente e espírito.
(Adaptado de: RAMIREZ, A. ; RIBEIRO, Á. Doping genético e esporte.)
Com base no texto, na teoria de Habermas e considerando as implicações éticas envolvidas nas disputas entre atletas, assinale a alternativa correta.
a) A utilização de terapias genéticas em atletas, por se assemelhar a uma dotação genética, não intencional, similar à da natureza, pode dispensar pressupostos éticos.
b) Por desconsiderar a utilização de drogas químicas, o uso do doping genético é eticamente aceitável no esporte, já que implica o aprimoramento genético da espécie.
c) O fato de um atleta ter sido submetido à terapia genética rompe com as condições de simetria entre os competidores, pressuposto ético básico das atividades esportivas.
d) A ideia de igualdade entre os atletas nas competições representa uma ficção, já que a vitória é a demonstração da real desigualdade entre eles, fator que legitimaria, do ponto de vista ético, o doping genético.
e) A igualdade dada pela indisponibilidade da natureza é fator ético que proíbe novas possibilidades genéticas, inviabilizando o grau de aperfeiçoamento moral que o ser humano poderia alcançar.
10. (PUC-MG) O esquema abaixo representa de forma resumida o processo utilizado na clonagem do primeiro mamífero.
10
Como base no esquema e em outros conhecimentos sobre o assunto, assinale a afirmativa incorreta.
a) Se a fusão de dois ovócitos de uma ovelha gerasse um descendente, esse deveria ser geneticamente idêntico à doadora dos ovócitos.
b) O filhote produzido por esse processo deve apresentar DNA mitocondrial tanto da ovelha Finn dorset quanto da ovelha Scottsh blackface.
c) Não é possível garantir que todas as características observáveis na ovelha doadora da célula somática estejam presentes em seu descendente.
d) O filhote gerado pela ovelha Scottsh blackface é dito clone da ovelha Finn dorset por apresentar o mesmo genoma nuclear que esta última.
11. (PUC-RS) Para responder esta questão, considere as informações do texto e do quadro, que apresenta resultados simulados da análise pericial de DNA de um casal e de cinco supostas vítimas de acidente (V). Os exames de identificação molecular (DNA) de pessoas têm sido muito úteis para solucionar casos forenses ou de investigação de paternidade, já que se baseiam na identificação de marcas genéticas que, herdadas, devem aparecer simultaneamente no filho e em seu pai e/ou em sua mãe. No pior acidente aéreo da América Latina, ocorrido com o vôo TAM 3054, no qual 199 pessoas perderam a vida, equipes de peritos analisaram o DNA das vítimas fatais, comparando com o DNA de pessoas aparentadas, e chegaram a resultados semelhantes aos apresentados no quadro seguinte:
11
Com base na análise de cada coluna e no padrão de linhas presente na simulação acima, os peritos poderiam concluir corretamente que o descendente do casal (Pai e Mãe) é a vítima:
a) V1.
b) V2.
c) V3.
d) V4.
e) V5.
12. (CESGRANRIO) “Bactérias formam clones desde o início da vida na Terra”
(Imprensa Local, setembro/97)
Hoje, algumas espécies de tatus produzem, por clonagem, de quatro a doze filhotes. Esse tipo de clonagem é possível porque:
a) A fêmea produz um grande número de ovos.
b) Os zigotos formados são consequência de meioses constantes.
c) O zigoto formado é capaz de se dividir várias vezes.
d) A grande produção de gametas masculinos garante o desenvolvimento dos zigotos.
e) As mitoses existentes em cada zigoto são consequência de recombinação gênica.
13. (UFAM) Criaram a primeira célula artificial do mundo. Primeiro, os pesquisadores decifraram, transformaram em informação computacional, alteraram e remontaram o genoma de uma bactéria causadora de doença em cabras chamada Mycoplasma mycoides. Esse novo genoma foi inteiramente criado em computador, sintetizado e implantado no citoplasma de uma bactéria de uma espécie aparentada. O genoma sintético “ligou” o citoplasma e fez a bactéria viver e se replicar. Num futuro próximo, células sintéticas poderão ser usadas para produzir biocombustíveis e remédios, entre outras substâncias.
Fonte: http://oglobo.globo.com/ciencia/mat/2010/05/21/daibacomo-foi-feita criacao-da-primeira-celula-artificial-do-mundo-uma-nova-vida-gerada-em-computador-916645364.asp Acessado em 23/05/2010.
O texto comenta sobre o potencial dessa nova tecnologia e, para seu entendimento, exige certo conhecimento sobre o funcionamento celular. As alternativas abaixo mostram as interpretações de cinco estudantes acerca das informações fornecidas. Assinale, à luz da Biologia Celular, a(s) correta(s):
I    II
0  0 – As novas estruturas da célula sintética são integralmente artificiais, assim como sua membrana plasmática e seu mecanismo de replicação.
1  1 – A passagem da informação genética da célula artificial para seus descendentes foi possível graças ao papel de enzimas conhecidas como DNA polimerases.
2  2 – Incorporar material genético artificial a uma célula viva significa dizer que cadeias polipeptídicas inteiras foram introduzidas no DNA hospedeiro e passaram a fazer parte dessa molécula como comumente observado nos seres vivos.
3  3 – A criação dessa célula artificial representa um marco da ciência, visto que o homem sempre objetivou criar “vida” em condições de laboratório. Assim, finalmente foi provado que as ideias iniciais sobre a geração espontânea estavam corretas.
4  4O termo “célula artificial” não seria o mais indicado visto que uma célula hospedeira foi usada para receber o “DNA sintético”.
14. (UFVJM)                 LEIA O TEXTO E ANALISE A FIGURA.
Uma ovelha foi produzida por meio de uma técnica em que se retira o núcleo de uma célula da glândula mamária de um animal adulto. Em seguida esse núcleo é fundido, com a ajuda de uma corrente elétrica, a um óvulo de outra ovelha que teve seu núcleo retirado. Esse óvulo é, então, implantado no útero. Das 277 tentativas, apenas uma vingou: a Dolly. Um cientista está cultivando células para clonar um mamífero, repetindo a técnica utilizada para gerar a Dolly. Ele observou uma divisão celular em sua cultura, que aparece nesta ilustração.
14
Com base nessas informações, é correto afirmar que esse cientista pretende, com as células dessa cultura, utilizar:
a) O núcleo, já que as células das glândulas mamárias possuem apenas um conjunto cromossômico.
b) O citoplasma e descartar o núcleo, já que se trata de um óvulo cujo núcleo tem apenas um genoma.
c) Os cromossomos dos óvulos, já que eles carregam DNA, que tem codificadas todas as informações genéticas.
d) O núcleo, já que as células das glândulas mamárias têm dois genomas completos, o que é vantajoso para a clonagem.
15. (UFJF) As principais proteínas responsáveis pela transição de fases do ciclo celular são chamadas de quinases dependentes de ciclina (CDKs). Com o objetivo de inibir a atividade da CDK de milho pesquisadores desenvolveram plantas transgênicas que continham um alelo mutante que codifica essa CDK sem a capacidade de transferir P para outras proteínas. Dentre as várias plantas transgênicas obtidas, os pesquisadores selecionaram uma planta na qual um dos alelos selvagens que codifica a CDK funcional foi substituído pelo alelo mutante. Esses pesquisadores se surpreenderam ao observar que essa planta heterozigota já apresentava atividade de CDK completamente inibida, porque:
a) Como as plantas transgênicas heterozigotas apresentam dois alelos selvagens, a proteína CDK não deveria estar completamente inibida nessas plantas.
b) O resultado obtido demonstrou que o alelo mutante introduzido na planta transgênica era dominante em relação ao alelo selvagem, justificando o seu fenótipo.
c) O resultado obtido demonstrou que o alelo mutante introduzido na planta transgênica era recessivo em relação ao alelo selvagem, justificando o seu fenótipo.
d) Nas plantas transgênicas homozigotas, somente o alelo mutante estaria presente e, assim, a proteína CDK não seria completamente inibida nessas plantas.
e) O resultado obtido demonstrou que as plantas transgênicas perderam o alelo selvagem e, por isso, a CDK estava completamente inibida nessas plantas.
16. (PASUSP) “Criada vida artificial” e “Ciência cria primeira célula sintética” foram algumas das manchetes que citaram o trabalho de Craig Venter, publicado na revista Science. Na realidade, foi uma bela obra de engenharia genética, mas não se criou vida. A equipe de cientistas utilizou vidas existentes, tanto de bactérias como de leveduras, para conseguir esse feito. Foram 15 anos de trabalho, envolvendo 24 cientistas, a um custo de US$ 40 milhões. (…) A estratégia para criar a bactéria de Craig Venter poderá permitir aprimorar as técnicas de engenharia genética, produzindo novos microrganismos úteis ao homem, como, por exemplo, bactérias mais eficientes em degradar a celulose ou o plástico, gerando novas formas de combustível biodegradável.
Mayana Zatz, Pesquisa Fapesp, Edição impressa nº 172, Junho 2010. Adaptado.
Considere as seguintes afirmações, elaboradas com base na leitura do texto:
I. O cientista Craig Venter criou vida artificial ao empregar técnicas de engenharia genética.
II. As bactérias sintetizadas pelos pesquisadores são capazes de degradar celulose e plástico.
III. Leveduras e bactérias foram os organismos empregados nos experimentos de Craig Venter.
IV. Novos microrganismos, úteis ao homem, poderão ser criados com o aprimoramento das técnicas de engenharia genética.
São corretas apenas as afirmações:
a) I e II.
b) I e III.
c) II e III.
d) II e IV.
e) III e IV.
17. (UFPI) Células microbianas, plantas e animais são usados na produção de materiais úteis às pessoas, tais como alimentos, remédios e produtos químicos. A respeito do DNA recombinante e da biotecnologia, analise as proposições abaixo e marque a alternativa que contempla somente informações corretas.
a) Uma cópia de DNA pode ser feita a partir de rRNA, constituindo uma biblioteca de DNA. Após a extração do rRNA de um tecido, este é misturado com a enzima transcriptase reversa, um pequeno primer de oligo dT é adicionado e hibridiza-se com a cauda poli A, para a síntese do cDNA, pela transcriptase, em seguida o rRNA é removido, deixando a fita única de cDNA.
b) Fragmentos de DNA, gerados por clivagem com o uso das enzimas de restrição, podem ser separados com a técnica de eletroforese em gel e suas frequências identificadas por sonda de DNA, pela técnica de hibridização molecular.
c) Cromossomos humanos, na construção de uma biblioteca gênica, são quebrados em fragmentos de DNA e inseridos em bactérias, que os replicam sem a necessidade de vetores construídos por fragmentos de cromossomos e plasmídeos.
d) As endonucleases de restrição são usadas na clivagem do DNA em seqüências específicas e são produzidas por vírus em defesas de invasões de DNA, por meio das quais as referidas endonucleases, sem alterar o seu DNA, produzem as enzimas que catalisam a clivagem de moléculas de DNA de dupla-hélice.
e) A produção comercial do hormônio do crescimento humano é um exemplo de expressão de genes em camundongo, desde que o gene de interesse possa ser expresso durante a transcrição.
18. (UNESP)                                 EU E MEUS DOIS PAPAIS
No futuro, quando alguém fizer aquele velho comentário sobre crianças fofinhas: “Nossa, é a cara do pai!”, será preciso perguntar: “Do pai número um ou do número dois?”. A ideia parece absurda, mas, em princípio, não tem nada de impossível. A descoberta de que qualquer célula do nosso corpo tem potencial para retornar a um estado primitivo e versátil pode significar que homens são capazes de produzir óvulos, e mulheres têm chance de gerar espermatozoides. Tudo graças às células iPS (sigla inglesa de “células-tronco pluripotentes induzidas”), cujas capacidades “miraculosas” estão começando a ser estudadas. Elas são funcionalmente idênticas às células-tronco embrionárias, que conseguem dar origem a todos os tecidos do corpo. Em laboratório, as células iPS são revertidas ao estado embrionário por meio de manipulação genética.
(Revista Galileu, maio 2009.)
Na reportagem, cientistas acenaram com a possibilidade de uma criança ser gerada com o material genético de dois pais, necessitando de uma mulher apenas para a “barriga de aluguel”. Um dos pais doaria o espermatozoide e o outro uma amostra de células da pele que, revertidas ao estado iPS, dariam origem à um ovócito pronto para ser fecundado in vitro. Isto ocorrendo, a criança:
a) Necessariamente seria do sexo masculino.
b) Necessariamente seria do sexo feminino.
c) Poderia ser um menino ou uma menina.
d) Seria clone genético do homem que forneceu o espermatozoide.
e) Seria clone genético do homem que forneceu a célula da pele.
19. (UESPI) Muitas esperanças são depositadas nas células-tronco, no tratamento de doenças graves, como aquelas referidas na charge abaixo. Sobre as células-tronco, é correto afirmar que:
19
a) Aquelas encontradas na medula óssea são especializadas na produção de osteoblastos.
b) Tais células são obtidas de óvulos e espermatozoides, uma vez que formam o zigoto.
c) Poderiam ser obtidas de embriões e teriam a capacidade de se diferenciar em neurônios e em células do miocárdio.
d) Se isoladas do cordão umbilical, têm aplicação particularmente no tratamento de condições médicas em bebês recém-nascidos.
e) No caso de pequenas amputações, poderiam regenerar o órgão perdido.
20. (UEL)      LEIA O TEXTO A SEGUIR E RESPONDA ESTA QUESTÃO.
Doping pode ser compreendido como a utilização de substâncias ou método que possa melhorar o desempenho esportivo e atente contra a ética esportiva em determinado tempo e lugar, com ou sem prejuízo à saúde do esportista. Em uma época em que as ciências do esporte aportam cada vez mais decisivamente elementos para a melhoria do desempenho esportivo dos praticantes de esporte de alto rendimento, em particular, e de atividades físicas, em geral, ganham em importância discussões acerca da utilização de metodologias biomoleculares e substâncias em suas mais amplas aplicações. Quer do ponto de vista sanitário ou ético, o doping genético tem suscitado debates tão intensos quanto questionáveis do ponto de vista científico. A questão que se coloca consiste em indagar se o recurso obtido com tecnologias biomoleculares se choca com a ideia de espírito esportivo, essência do Olimpismo, pautado pela busca do equilíbrio entre corpo, mente e espírito.
(Adaptado de: RAMIREZ, A. ; RIBEIRO, Á. Doping genético e esporte.)
Com base no texto e nos conhecimentos sobre terapia gênica, considere as afirmativas a seguir.
I. Um gene funcional pode ser inserido em local não específico do genoma para a substituição de um gene não funcional.
II. Um gene não funcional pode ser substituído por um gene funcional por recombinação genética.
III. Um gene não funcional pode ser corrigido por apoptose, o que retorna o gene à sua composição normal.
IV. Uma cópia funcional do alelo pode ser adicionada em substituição ao alelo não funcional.
Assinale a alternativa correta.
a) Somente as afirmativas I e II são corretas.
b) Somente as afirmativas I e III são corretas.
c) Somente as afirmativas III e IV são corretas.
d) Somente as afirmativas I, II e IV são corretas.
e) Somente as afirmativas II, III e IV são corretas.
21. (UFF) “Kôkôtêrô voltou-se rapidamente. Viu, no lugar em que enterrara a filha, um arbusto mui alto, que logo se tornou rasteiro assim que se aproximou. Tratou da sepultura. Limpou o solo. A plantinha foi-se mostrando cada vez mais viçosa. Mais tarde, Kôkôtêrô arrancou do solo a raiz da planta: era a mandioca.”
(Brandenburger, C. Lendas dos Nossos Índios).
A mandioca é um dos principais alimentos cultivados no Brasil até os dias de hoje. Essa planta está associada à cultura de diversos grupos indígenas no território brasileiro, que utilizam a estaquia simples como o principal método de propagação para o cultivo deste vegetal. Assinale a técnica genética com a qual a estaquia está relacionada.
a) Transgênese.
b) Recombinação genética.
c) Mutação sítio-dirigida.
d) Reprodução sexuada induzida.
e) Clonagem.
22. (FGV) INSTITUTO NACIONAL DE PROPRIEDADE INDUSTRIAL – INPI – NEGA PATENTE AO ANTI-RETROVIRAL TENOFOVIR. A DECISÃO TRAZ NOVA PERSPECTIVA PARA NEGOCIAÇÃO DE PREÇOS DO MEDICAMENTO.
(“O Estado de S. Paulo”, 02.09.2008)
O Tenofovir é um dos mais caros e importantes medicamentos anti-HIV usados no Programa Nacional de DST – Aids. Tem ação antirretroviral, pois se trata de um análogo de nucleosídeo e, quando da transcrição reversa, suas moléculas substituem o nucleotídeo verdadeiro, no caso, a adenina. O produto sintetizado com a falsa adenina perde a sua função. Pode-se dizer que moléculas do medicamento vão substituir a adenina quando da síntese:
a) Do RNA viral por ação da transcriptase reversa.
b) Das proteínas virais a partir do RNA do vírus.
c) Do DNA a partir do RNA do vírus.
d) Da transcriptase reversa do vírus.
e) Da DNA polimerase que faz a transcrição do material genético do vírus.
23. (IFSC) Considerando os efeitos da inserção de organismos geneticamente modificados ou transgênicos na agricultura, assinale a(s) proposição (ões) correta(s).
I   II
0  0 – A Lei de Biossegurança estabelece normas e mecanismos de fiscalização das atividades que envolvem transgênicos e seus derivados no Brasil.
1  1 – No Brasil, os organismos geneticamente modificados não estão liberados para produção ou comercialização, sendo de uso restrito para pesquisas científicas.
2  2 – A eliminação de insetos e microrganismos do ecossistema, a contaminação de culturas convencionais, dos solos e lençóis freáticos, em decorrência da produção de alimentos transgênicos, são polêmicas que envolvem a introdução dos organismos geneticamente modificados na agricultura.
3  3 – A necessidade em elevar a produtividade agrícola, sem aumentar a área cultivada, favoreceu a inserção e disseminação dos transgênicos na agricultura.
4  4 -As pesquisas sobre alimentos transgênicos são conclusivas e descartam que a produção e o consumo dos organismos geneticamente modificados acarretam prejuízos à saúde humana e animal.
24. (UFRN) O texto abaixo reproduz parte de uma reportagem do programa “Globo Rural” que abordou uma Norma Federal reguladora do cultivo de milho transgênico e do milho convencional.
“Em cada propriedade, o fiscal federal agropecuário faz o teste na lavoura. A folha é misturada a uma solução que aponta se a proteína da planta é geneticamente modificada. O resultado sai em cinco minutos. […]
Toda essa tecnologia é usada para ajudar o produtor rural a cumprir uma norma que existe desde 2007, que determina o espaçamento necessário entre a lavoura de milho convencional e a lavoura de milho transgênico do vizinho.
Quando uma lavoura de milho transgênico faz divisa com outra que tem milho convencional o produtor deve respeitar a distância mínima de isolamento de cem metros. Se isso não for possível, o proprietário do milho transgênico deve fazer uma borda com 20 metros onde tenha pelo menos dez linhas de milho convencional. […]”
“Com isso, estaremos garantindo para o agricultor vizinho que, se planta milho convencional, ele possa vender como milho convencional. Se a gente não fizer isso, o vizinho que planta o milho convencional do lado de quem planta milho transgênico, vai ter que vender o milho como transgênico”, explicou o agrônomo Rodrigo Pita.”
Disponível em: http://globoruraltv.globo.com/GRural/0,27062,LTO0-4370-341389,00.html. Acesso em: 8 jul.2010.
Para que o agricultor continue a ter sua plantação classificada como milho convencional, o cumprimento da Norma reduz a possibilidade de:
a) Contaminação da planta convencional com uma proteína estranha.
b) Manutenção da quantidade normal do pólen produzido pelas anteras.
c) Deformação nas estruturas das anteras e dos pistilos.
d) Contato do pólen da planta transgênica com a convencional.
25. (UNIR) Analise as células e estruturas apresentadas na figura abaixo.
25
Sobre o desenvolvimento embrionário nos mamíferos, assinale a(s) afirmativa(s) correta(s).
( ) As células do embrião de 8 dias são células-tronco capazes de se diferenciarem no zigoto e nos anexos embrionários do blastocisto.
( ) As células externas do blastocisto se diferenciam nos anexos embrionários.
(  ) No interior do blastocisto, são encontradas as células-tronco capazes de se transformarem em todos os tipos de tecido, menos nos anexos embrionários.
( ) Nos tecidos diferenciados constantes da figura, são encontradas as células-tronco com capacidade de originar qualquer tipo de tecido.
Assinale a sequência correta.
a) V, F, V, F.
b) F, V, V, F.
c) F, F, V, F.
d) V, V, F, V.
e) F, V, V, V.
26. (UFPel) Pesquisadores egípcios estão mudando o contar da História por meio de testes genéticos (Hawass et al., 2010). Eles colheram material de 10 múmias, identificadas como pertencentes à família de Tutancâmon e, também, dos restos mortais do próprio faraó. Os resultados do estudo envolvem análises de DNA, tomografias, provas arqueológicas e registros históricos. Com base em análise de microssatélites, regiões repetitivas do DNA usadas em testes de paternidade, duas das múmias foram consideradas como sendo os pais do faraó e, muito provavelmente, Tutancâmon foi gerado num ato incestuoso.
HAWASS, Z. et al. Ancestry and pathology in King Tutankhamun’s family. JAMA, 303(7):638-647, 2010. FRANCO, F.M. 2010. Do laboratório à sala de aula: os recentes avanços da Genética. Genetica na escola, v.5, n.1, 2010. Disponivel em http://www.geneticanaescola.com.br/ano5vol1/MS16_009.pdf.
Com base em seus conhecimentos e no texto, é correto afirmar que, para a identificação dos pais do faraó Tutancâmon:
a) Trechos de DNA das múmias foram cortados pela enzima DNA-ligase, que corta o DNA em pontos específicos, onde ha determinadas sequencias de bases nitrogenadas. Os fragmentos de DNA de cada múmia foram separados pela técnica de PCR e comparados.
b) Amostras de DNA das múmias foram analisadas diretamente por meio da técnica de eletroforese. Deve haver pelo menos 25% de coincidência entre o DNA de Tuntancamon com o de cada um de seus pais.
c) Trechos de DNA das múmias foram cortados por enzimas de restrição, que cortam o DNA em pontos específicos, onde há determinadas sequencias de bases nitrogenadas. Os fragmentos de DNA de cada múmia foram separados por eletroforese e comparados.
d) Amostras de DNA das múmias foram submetidas a ação da enzima DNA polimerase, que corta a fita em fragmentos, que são separados pela técnica de PCR para, posteriormente, serem comparados.
e) Trechos de DNA mitocondrial das múmias foram cortados por enzimas de restrição, que cortam o DNA em pontos específicos. Os fragmentos de DNA de cada múmia foram separados pela técnica de PCR e comparados.
27. (FUVEST) Vegetais e animais transgênicos:
a) São mutantes que têm o seu genoma alterado por processos como radiação, para desenvolvimento de características específicas.
b) Passaram por processo de clonagem, onde sofrem transplante de órgãos em experiências científicas, para desenvolvimento de fenótipos específicos.
c) Têm o seu fenótipo alterado mediante ação de mecanismos físicos ou biológicos, mas não passam as alterações sofridas às gerações seguintes.
d) São seres modificados por biotecnologia, que consiste na inserção de genes provenientes de outros organismos ao genoma que se deseja modificar.
e) Tiveram o seu DNA alterado por variações climáticas, que provocaram a deleção de genes, o que ocasionou modificações nos fenótipos.
28. (UESPI) Muitas ferramentas moleculares permitem atualmente alterar a informação genética de um organismo de forma que este apresente alguma vantagem fenotípica. Assim:
a) As técnicas de transgenia têm o objetivo de tornar plantas resistentes a pragas.
b) A clonagem de animais os deixa mais resistentes a doenças.
c) Enzimas de restrição cortam o DNA aleatoriamente facilitando a retirada de fragmentos que podem ser transferidos.
d) Plasmídios bacterianos são usados como vetores de genes de interesse, pois induzem naturalmente resistência a antibióticos.
e) A terapia genética de doenças humanas pretende alterar o código genético inibindo a expressão fenotípica de genes maléficos.
29. (UECE)         LEIA ATENTAMENTE AS INFORMAÇÕES A SEGUIR:
“O processo de clonagem em seres como bactérias e outros organismos unicelulares que realizam sua reprodução através do processo de bipartição ou cissiparidade pode ser frequentemente observado na natureza. No caso dos seres humanos, podemos considerar gêmeos univitelinos como clones naturais, pois esses indivíduos compartilham as mesmas características genéticas, originárias da divisão do óvulo fecundado. Porém, foi somente no ano de 1997 que a comunidade científica demonstrou ser possível produzir clones de animais em laboratório, quando o embriologista Ian Wilmut, do Instituto de Embriologia Roslin, na Escócia, conseguiu clonar uma ovelha, batizada de Dolly. Após esta experiência, vários animais, como bois, cavalos, ratos e porcos, foram clonados.”
É correto considerar que a clonagem artificial de animais consiste em:
a) Introduzir, no óvulo de uma fêmea de determinada espécie, um espermatozoide de um macho da mesma espécie.
b) Retirar e descartar o núcleo de uma célula somática de uma fêmea de determinada espécie e injetar, nessa célula enucleada, o núcleo de uma célula ovo da mesma espécie.
c) Retirar e descartar o núcleo do óvulo de uma fêmea de determinada espécie e injetar, neste óvulo enucleado, o núcleo de uma célula somática de um indivíduo da mesma espécie.
d) Introduzir o núcleo de uma célula somática retirado de uma fêmea dentro de um óvulo retirado dessa mesma fêmea.
30. (UFT) Sabendo que as enzimas de restrição são capazes de cortar o DNA em sítios específicos. Analise a sequência de DNA abaixo em relação às enzimas propostas e marque a alternativa incorreta.
DNA: 5’GATTACAATTTCGACCTTGCAATTCCGGTGAGAC3’
Enzima I (corta após AATT)
Enzima II (corta após CCTT)
a) Após ação das enzima I obtemos três fragmentos de DNA.
b) Após ação da enzima II obtemos dois fragmentos de DNA.
c) Após ação das enzimas I e II obtemos quatro fragmentos de DNA.
d) Após ação da enzima I obtemos dois fragmentos de DNA.
e) A enzima II corta o DNA em dois fragmentos de comprimentos diferentes.

GABARITO


01
02 03 04 05 06 07 08 09
10
C
D VVVFF A D C C D C
A
11
12 13 14 15 16 17 18 19
20
A
C FVFFV C B E B C C
D
21
22 23 24 25 26 27 28 29
30
E
C VFVVF D B C D E C
D

21 de jul de 2016

FOTOSSÍNTESE

A conversão da energia solar em energia química é um processo físico-químico realizado por seres autótrofos e clorofilados, denominado fotossíntese. A organela responsável por esse processo são os cloroplastos, que são constituídos de pigmentos fotossintéticos, representado principalmente pela clorofila (há também pigmentos acessórios como carotenoides e ficobilinas), que ficam imersos na membrana dos tilacóides, formando o complexo-antena, responsáveis por captar a energia luminosa.  
Esquema geral da fotossíntese (Foto: Colégio Qi)Esquema geral da fotossíntese (Foto: Colégio Qi)
Na presença de luz e clorofila, o gás carbônico e a água são convertidos em glicose, havendo liberação de oxigênio. O oxigênio, na atmosfera, proveniente da quebra da água, é de extrema importância para a manutenção da sobrevivência dos seres vivos aeróbios no planeta. Durante a respiração, a planta consome oxigênio e libera gás carbônico no ambiente. Entretanto, em condições normais, a taxa de fotossíntese é maior que a respiração, podendo equivaler-se, denominado ponto de compensação fótico, onde a velocidade de fotossíntese e respiração é igual.  A fotossíntese ocorre em duas etapas: a fase fotoquímica ou fase clara e a fase química ou fase escura.

18 de jul de 2016

LISTA SOBRE DOENÇAS

01. (UPE)
ESTABELEÇA A CORRETA ASSOCIAÇÃO ENTRE AS COLUNAS.
PARASITOSE
A. Teníase.
B. Elefantíase.
C. Leishmaniose visceral.
D. Esquistossomose.
E. Giardíase.
MANIFESTAÇÕES DA DOENÇA
1. Diarreia, dor abdominal, falta de apetite, anemia.
2. Febre, anemia, emagrecimento, aumento do fígado e do baço.
3. Anemia, fezes sanguinolentas, diarreia, febre, aumento do fígado e do baço.
4. Dor de cabeça, diarreia, constipação intestinal, falta de apetite.
5. Edemas causados por obstrução dos vasos linfáticos.
PROFILAXIA
I. Combater o mosquito transmissor e usar telas e mosquiteiros.
II. Lavar e cozinhar bem os alimentos e realizar saneamento básico.
III. Combater o molusco transmissor e realizar saneamento básico.
IV. Salgar e cozer as carnes e realizar saneamento básico.
V. Combater o mosquito transmissor e eliminar cães infectados.
Assinale a alternativa correta.
a) A 1 IV, B 5 III, C 3 I, D 2 II e E 4 V.
b) A 2 V, B 5 I, C 4 IV, D 3 III e E 1 II.
c) A 1 II, B 4 III, C 2 V, D 5 I e E 3 IV.
d) A 1 III, B 5 I, C 3 II, D 4 IV e E 2 V.
e) A 4 IV, B 5 I, C 2 V, D 3 III e E 1 II.
02. (UECE) Leia o texto a seguir:
Jeca Tatu, personagem famoso de Monteiro Lobato era um homem que vivia na miséria e que morava perto de um pequeno riacho, no qual ele podia pescar. Sem cultura, ele não cultivava de forma alguma os necessários hábitos de higiene. Era visto pelas pessoas como preguiçoso e alcoólatra. Até que um dia um médico que passava pela sua residência nota sua coloração amarela e sua intensa magreza e decide examinar o caboclo. Jeca Tatu se queixa de muita fadiga e dores corporais e o doutor então, diagnostica a presença de uma enfermidade tecnicamente conhecida como ancilostomose, o famoso amarelão.
Sobre a ancilostomose, é correto afirmar-se que:
a) É uma verminose cujas larvas podem se instalar no cérebro, condição conhecida como cisticercose cerebral.
b) As larvas que atravessam as paredes do intestino delgado se direcionam aos vasos sanguíneos e linfáticos, espalham- se pelo organismo, atingem a faringe, e somente são liberadas juntamente com a tosse ou muco.
c) Os vermes adultos se instalam no aparelho digestivo dos seres humanos, nutrindo-se de sangue do hospedeiro e causando anemia.
d) A contaminação se dá exclusivamente pela ingestão de ovos do verme, geralmente encontrados no solo, na água, em alimentos e em mãos que tiveram um contato anterior com fezes animais contaminadas.
03. (FPS) Desde a infestação, até o final do ciclo de vida do parasita, vários são os efeitos deletérios causados no hospedeiro. Quais parasitas causam obstruções, intestinal e linfática, respectivamente?
a) Filária e oxiúro.
b) Ameba e leishmania.
c) Lombriga e filária.
d) Ancilóstomo e lombriga.
e) Leishmania e ancilóstomo.
04. (UDESC) Nos últimos dias vários meios de comunicação têm noticiado casos de dengue em diferentes Estados do Brasil. Em alguns destes Estados os números indicam uma situação epidêmica, segundo os parâmetros da Organização Mundial de Saúde (OMS). Analise as proposições em relação à dengue, e assinale (V) para verdadeira e (F) para falsa.
( ) A doença é adquirida pela picada de um hemíptero, denominado cientificamente deTriatoma infestans.
( ) Existem duas formas de dengue: a clássica e a hemorrágica.
( ) Por ser uma doença causada por bactérias do grupo Neisseria, a dengue pode ser tratada com antibiótico, o que garante a cura em mais de 90% dos casos.
( ) Uma das medidas mais eficazes do combate à dengue são as campanhas de vacinação, realizadas anualmente.
( ) Após contaminar-se uma vez com a dengue, o indivíduo adquire imunidade natural e não mais contrai a doença.
Assinale a alternativa que indica a sequência correta, de cima para baixo.
a) V – V – F – F – V.
b) V – V – V – F – V.
c) V – F – F – F – V.
d) F – V – F – F – F.
e) V – V – V – V – V.
05. O Ebola é um organismo que, provavelmente, tenha se originado no Zaire e no Sudão em 1976. Mata suas vítimas em poucos dias. Na primeira fase da doença, os sintomas lembram os da malária, mas por volta do quarto dia já é considerado crítico: febre alta, hemorragia generalizada espontânea, fezes sanguinolentas e vômitos com jatos de sangue. Surgem várias feridas que se espalham pelo corpo rapidamente. A vítima morre por volta do nono dia. No Zaire, o índice de mortalidade chega a 90% das pessoas infectadas.
Fonte: Jornal Extra – 03/06/2006
De acordo com o texto é correto afirmar que:
a) o Ebola é uma bactéria.
b) o Ebola é um protozoário é um protozoário flagelado.
c) o Ebola é um verme platelminto.
d) o Ebola é um vírus de RNA.
e) o Ebola é um inseto.
06. (UNICID) A tuberculose e a candidíase são doenças humanas cujos agentes etiológicos pertencem a grupos distintos de seres vivos. Esses agentes apresentam, porém, algumas características em comum, entre as quais:
a) Formação de hifas septadas ou cenocíticas com diversos núcleos e presença exclusiva de ribossomos no citosol.
b) Sensibilidade a antibióticos, como a penicilina, e presença da enzima transcriptase reversa para sintetizar DNA.
c) Presença de parede celular, com composições químicas diferentes, e capacidade de sintetizar suas próprias proteínas.
d) Capacidade de sintetizar moléculas de monossacarídeos nos cloroplastos e capacidade de sofrer constantes mutações.
e) Presença de moléculas de DNA circulares chamadas plasmídeos e presença de lisossomos, que realizam a digestão intracelular.
07. (UNIFOR) Um biólogo recebe, para identificar, um animal vermiforme desconhecido. Após estudar os aspectos anatômicos e histológicos, o pesquisador verifica que o exemplar possui certas características: Hermafrodita, medindo de 5 metros de comprimento. Possui escólex globoso, tendo 4 ventosas e um rostro com dentes quitinosos. O colo é curto e o estróbilo apresenta aproximadamente 1000 anéis, possuindo proglotes jovens (largas), maduras (quadrangulares) e grávidas (longas com ramificações uterinas e terminações arborescentes). Marque a opção que apresenta o parasita identificado pelo biólogo e a doença ocasionada por ele, respectivamente:
a) Taenia solium e cisticercose.
b) Necator americanus e esquistossomose.
c) Taenia sp. colitite teniana.
d) Ancylostoma duodenale e amarelão.
e) Taenia saginata e teníase.
08. (PUC-SP) A leishmaniose – também chamada de febre dum-dum ou calazar (“febre negra”, em hindi) – é uma parasitose transmitida por insetos flebótomos (…)
Se não for tratada, a leishmaniose visceral, a forma interna da doença, quase sempre mata. (Há também uma forma cutânea desfigurante.) (…)
Apesar de aparentemente terrível, a doença tem incidência muito menor do que a malária, sendo, portanto, muito mais fácil distribuir um medicamento recém aprovado contra ela.
Na Índia, uma nova droga antiparasita foi utilizada em um ensaio clínico com 670 pacientes. O parasita causador da doença tornara-se resistente aos medicamentos disponíveis, compostos baseados no antimônio.
(Scientific American Brasil, nº 27, agosto de 2004, adaptado)
Utilizando informações contidas no texto e seus conhecimentos sobre parasitoses e evolução, um estudante fez três afirmações:
I. O agente etiológico da leishmaniose é o mesmo que causa a malária.
II. O agente transmissor da leishmaniose é um mosquito.
III. O antimônio provocou mutações no parasita da leishmaniose, tornando-o resistente a certos medicamentos.
Pode-se considerar:
a) Apenas I verdadeira.
b) Apenas II verdadeira.
c) Apenas I e III verdadeiras.
d) Apenas II e III verdadeiras.
e) I, II e III verdadeiras.
09. (URCA) Hábitos simples como lavar as mãos antes de manusear alimentos pode evitar que pessoas sejam parasitadas por vermes e protozoários, parasitas gastrointestinais. São exemplos de parasitas contraídos através de ovos ou cistos encontrados em alimentos contaminados:
a) Ascaris lumbricoides Entamoeba histolítica.
b) Necator americanos Trypanossoma cruzi.
c) Leishmania brasiliensis Amoeba proteus.
d) Fasciola hepática Giardia lamblia.
e) Strongiloides stercoralis e Schistosoma mansoni.
10. (CEFET-MG) A síndrome da imunodeficiência adquirida, conhecida popularmente como AIDS, é uma doença transmitida por um vírus que tem como material genético o RNA. Ao infectar o linfócito TCD4+, importante célula de defesa do corpo, esse vírus introduz, além do ácido nucleico, a transcriptase reversa. Essa enzima converte o RNA viral em DNA viral, possibilitando sua replicação, com consequente falência do sistema imunológico do indivíduo. Quando o número de linfócitos cai abaixo de 200 por mm3 de sangue, é necessário que o paciente faça uso do conjunto de medicamentos com ação antirretroviral, conhecido como coquetel. Considerando-se que, após esse tratamento, o número de linfócitos de um determinado paciente aumentou, é correto concluir que esse fármaco promoveu a:
a) Proliferação dos linfócitos TCD4+.
b) Inibição da enzima transcriptase reversa.
c) Destruição dos vírus presentes no paciente.
d) Imunização dos pacientes ao vírus da AIDS.
e) Incapacitação da transferência do RNA viral.
11. (UPE) Afirmativas sobre sistema imune e imunização.
I   II
0   0 – As vacinas têm o objetivo de desencadear, no organismo, um mecanismo de imunização ativa pela introdução das formas atenuadas das toxinas ou dos próprios microrganismos causadores das doenças.
1   1 – Os microrganismos causadores das doenças no nosso corpo, irão atuar como antígenos ou elementos estranhos, estimulando o nosso sistema imunológico a produzir proteínas especiais – os anticorpos.
2  2 – O anticorpo é uma molécula de proteína de papel defensivo, que reage com outras moléculas estranhas ao organismos, e os glóbulos brancos são células de defesa que podem englobar outras células por fagocitose.
3 3 – A anatoxina, quando inoculada no organismo, força a produção de anticorpos contra a toxina produzida por um microrganismo, protegendo o indivíduo dos efeitos de uma determinada doença.
4 4 – Na imunização ativa, o anticorpo é fabricado fora do corpo a ser imunizado e introduzido pronto e tem efeito lento e duradouro, uma vez que o sistema imunológico guarda, na memória, o anticorpo especifico.
12. (IFMT) Suspeita de vaca louca em MT não deve provocar embargos, diz Famato
Mapa investiga doença que afetou bovino em Porto Esperidião. O presidente da Famato, Rui Prado, disse nesta quinta-feira (24.04.2014) que não há motivos para restrições ou embargos comerciais à carne bovina de Mato Grosso e do Brasil, em função de uma suspeita de mal da vaca louca em um bovino do Estado. A investigação do caso provável de Encefalopatia Espongiforme Bovina (EEB) foi confirmada pelo Ministério da Agricultura, Pecuária e Abastecimento (Mapa). Amostras de material encefálico do animal doente foram encaminhadas para o laboratório de referência internacional da Organização Mundial de Saúde Animal (OIE), em Weybridge, na Inglaterra. A expectativa é que o resultado saia na próxima semana.
12
Acessado em 27.04.301417h20min.
A doença, vulgarmente denominada vaca louca, é causada pelo príon, que é uma forma anormal da molécula:
a) Do DNA.
b) Da proteína.
c) Do carboidrato.
d) Do lipídio.
e) Do RNA.
13. (UFPA) O mês de novembro marca a luta pelo controle da malária nas Américas. A data visa a incentivar os países das Américas a aumentar o diálogo e realizar campanhas contra a doença. A falta de informação sobre transmissão, diagnóstico e tratamento da malária é que ainda atrapalha o controle da doença, fazendo com que muitas pessoas acreditem que a malária pode ser transmitida pela ingestão de água, que chás e plantas medicinais podem curar e que se os sintomas da doença passarem a pessoa está curada.
Mitos e Crenças populares prejudicam o controle da Malária. Informações disponíveis em:http://bertagna.wordpress.com/2011/11/page/3/.Acesso em: 11 set. 2014 (Texto Adaptado).
Para desmistificar as crendices do senso comum com relação a essa doença, as autoridades deveriam enfatizar que a doença é transmitida de uma pessoa para a outra apenas através da picada do mosquito anófeles quando o mesmo inocula nas pessoas os:
a) Esporozoítos.
b) Merozoítos.
c) Tripomastigotas.
d) Amastigotas.
e) Esporocistos.
14. (UFG) Em março de 2014, a vacina contra infecções causadas por papilomavírus humanos (HPV) passou a integrar o Programa Nacional de Imunizações do Ministério da Saúde, tendo como objetivo principal reduzir:
a) A transmissão do vírus da síndrome da imunodeficiência humana.
b) A mortalidade decorrente de complicações da influenza.
c) O consumo de medicamentos por doentes infectados com o vírus ebola.
d) Os sintomas causados pela infecção.
e) A incidência de câncer de colo do útero.
15. (CEFET-MG) Dentre as doenças citadas, aquela em que seu agente causador não apresenta carioteca é a:
a) Giardíase.
b) Leptospirose.
c) Leishmaniose.
d) Doença de Chagas.
16. (UniEvangélica) Leia o texto a seguir.
Ainda esse mês chega ao Brasil a primeira vacina contra o herpes zóster, causador de doença pela reativação do vírus da catapora, devido à queda da imunidade, e que atinge principalmente idosos. Trata-se da mesma vacina contra a catapora, com vírus atenuado, mas com uma quantidade maior de antígenos, já que a resposta imune de idosos costuma ser menor.
Vacina contra herpes zoster. Folha de São Paulo. N. 31.056. Caderno Saúde+Ciência. 13 abr. 2014. p. C7.
O aumento na quantidade de antígenos na vacina contra herpes zóster:
a) Incitará uma resposta imune primária mais acentuada por parte dos linfócitos às moléculas do vírus atenuado.
b) Fará com que esses anticorpos forneçam uma proteção adicional contra infecções, enquanto o sistema imune do idoso se fortalece.
c) Determinará, em um possível encontro com o patógeno não atenuado do herpes zóster, uma resposta imunológica primária forte e rápida.
d) Determinará uma imunização passiva, que ocorre quando anticorpos são injetados em um organismo não imune.
17. (MACK)
17
Com relação ao gráfico acima, é correto afirmar que:
a) A curva A representa uma epidemia, como por exemplo, a malária.
b) A curva B representa uma epidemia, como por exemplo, a doença Ebola.
c) A curva A representa uma endemia, como por exemplo a AIDS.
d) A curva B representa uma pandemia, como por exemplo, a gripe.
e) A e B representam, respectivamente, uma epidemia como a doença Ebola e uma endemia como a esquistossomose.
18. (UNICAMP) Nos porões dos navios vindos do Oriente no século XIV, chegavam milhares de ratos à Europa, onde encontravam um ambiente favorável, dadas as condições precárias de higiene. Esses ratos estavam contaminados e suas pulgas transmitiam um agente etiológico aos homens através da picada. Os ratos também morriam da doença e, quando isto acontecia, as pulgas passavam rapidamente para os humanos, para obterem seu alimento, o sangue. Qual é o agente etiológico e qual é o nome popular dessa doença?
a) Vírus, peste bubônica.
b) Bactéria, peste bubônica.
c) Vírus, leptospirose.
d) Bactéria, leptospirose.
19. (UEPG) Uma importante questão de saúde humana constitui as doenças que passam de uma pessoa para a outra, principalmente através da relação sexual, as doenças sexualmente transmissíveis (DSTs). Sobre as DSTs, assinale o que for correto.
01. A gonorreia é causada pela bactéria Neisseria gonorrhoeae, que pode provocar inflamação da uretra, da próstata e do útero. Pode haver dor, ardência e uma secreção amarelada ao urinar.
02. A sífilis é causada pela bactéria Treponema pallidum. O primeiro sintoma é uma ferida sem dor, dura, com bordas elevadas e avermelhadas na área genital, ou, às vezes, no ânus, na boca ou em outras regiões que entraram em contato com a bactéria. A ferida some em duas a seis semanas, mesmo sem tratamento, mas a bactéria continua presente no organismo.
04. Na tricomoníase aparece uma secreção avermelhada, acompanhada de coceira nos órgãos genitais. É causada pelo fungo Candida albicans.
08. O condiloma genital forma verrugas nos órgãos genitais, no colo do útero e ao redor do ânus. É causado pelo papilomavírus humano.
16. A herpes genital é causada por um vírus. O local fica inicialmente vermelho e com coceira, surgindo depois pequenas bolhas, que arrebentam e formam feridas. Os sintomas desaparecem em até um mês, mas o vírus continua no organismo e, em algumas pessoas, provoca recaídas. Com esses sintomas presentes, o indivíduo é extremamente contagioso e deveria evitar relações sexuais para que não ocorresse transmissão.
Soma das alternativas corretas:
20. (UPF) Bactérias são organismos unicelulares e procariotos, que podem ser diferentes quanto ao metabolismo, ao habitat, à forma da célula e ao tipo de associação. Dada sua expressiva importância como agentes patogênicos, é fundamental saber reconhecê-las. Assim, associe as colunas abaixo, relacionando o tipo à aparência das bactérias.
20

A sequência correta de preenchimento dos parênteses, de cima para baixo, é:
a) 2 – 6 – 1 – 4 – 5 – 3.
b) 4 – 3 – 2 – 6 – 5 – 1.
c) 3 – 2 – 1 – 5 – 6 – 4.
d) 4 – 6 – 1 – 3 – 2 – 5.
e) 3 – 2 – 1 – 5 – 4 – 6.
gab

Follow by Email

Total de visualizações de página

 
Desenvolvido por Othon Fagundes